Journal: Oncotarget

Article Title: Up-regulation of fibroblast growth factor 19 and its receptor associates with progression from fatty liver to hepatocellular carcinoma

doi: 10.18632/oncotarget.10750

Figure Lengend Snippet: ( A ) the protein levels of FGF19 in serum from 24 HCC patients and 6 non-HCC controls, and in the tissues from 24 paired HCC-peritumoral and 6 non-HCC controls by ELISA analysis. ( B ) the mRNA levels of FGF19 and FGFR4 from 24 paired HCC-peritumoral tissues. ( C ) upper: Representative Western blot for β-Klotho protein detection of 5 paired tissues from HCC patients. Lower: the protein levels of β-Klotho in serum from 24 HCC patients and 6 non-HCC controls, and in the tissues from 24 paired HCC-peritumoral tissues by ELISA analysis. T: HCC tumor tissue; PT: peritumoral tissues.

Article Snippet: After rewashing, the slides were incubated separately with the monoclonal mouse FGF19 antibody (1:100), FGFR4 antibody (1:100), or EpCAM antibody (1:100) (SantaCruz Biotechnology Inc, CA) for 30 minutes at room temperature.

Techniques: Enzyme-linked Immunosorbent Assay, Western Blot

Journal: Oncotarget

Article Title: Up-regulation of fibroblast growth factor 19 and its receptor associates with progression from fatty liver to hepatocellular carcinoma

doi: 10.18632/oncotarget.10750

Figure Lengend Snippet: Representative immunohistochemical staining for FGFR4 and the computer quantification of FGFR4 expression from different stages. Magnification: 200×, the positive staining shown as brown color. PT: peritumoral tissues; ST: steatosis with diffuse lipid deposition; NASH: lipid deposition with inflammatory cells infiltration; CR: cirrhosis with regenerative nodule; HCC: hepatocellular carcinoma. * p < 0.05 vs PT.

Article Snippet: After rewashing, the slides were incubated separately with the monoclonal mouse FGF19 antibody (1:100), FGFR4 antibody (1:100), or EpCAM antibody (1:100) (SantaCruz Biotechnology Inc, CA) for 30 minutes at room temperature.

Techniques: Immunohistochemical staining, Staining, Expressing

Journal: Oncotarget

Article Title: Up-regulation of fibroblast growth factor 19 and its receptor associates with progression from fatty liver to hepatocellular carcinoma

doi: 10.18632/oncotarget.10750

Figure Lengend Snippet: ( A ) Positive correlation of FGF19 and FGFR4 expression in HCC ( r = 0.79) (p < 0.001). ( B ) Positive correlation of FGF19 and EpCAM expression in HCC ( r = 0.852) ( p < 0.001).

Article Snippet: After rewashing, the slides were incubated separately with the monoclonal mouse FGF19 antibody (1:100), FGFR4 antibody (1:100), or EpCAM antibody (1:100) (SantaCruz Biotechnology Inc, CA) for 30 minutes at room temperature.

Techniques: Expressing

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: KLB mediates FGFR4 downstream signaling and phosphorylation of pro-survival proteins . 72 h post-transfection with siRNA, Huh7 cells were lysed, resolved with 7.5% SDS-PAGE and immunoblotted using the indicated antibodies. Results are indicative of two independent experiments.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Transfection, SDS Page

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: Silencing of KLB or FGFR4 increases expression of liver stemness genes . (A) 48 h post siRNA silencing of KLB or FGFR4 in Huh7 cells, AFP gene expression was determined by qRT-PCR. Data indicates fold change in gene expression normalized to scrambled siRNA. Error bars represent SD converted to fold changes. (B) After 72 h, AFP protein expression was also determined using polyclonal anti-AFP antibodies, normalized to β-actin as loading control. (C) CD133 and CD44 expression after KLB-silencing was subsequently determined as described for (A). (D) The effect of the silencing on CD133 protein expression was performed using anti-CD133 antibody. (E) CD133 and CD44 mRNA levels were measured in Huh7 stable clones expressing control shRNA and FGFR4 shRNA after normalizing to GAPDH.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Expressing, Quantitative RT-PCR, Clone Assay, shRNA

Journal: Molecular Cancer

Article Title: Klotho-beta overexpression as a novel target for suppressing proliferation and fibroblast growth factor receptor-4 signaling in hepatocellular carcinoma

doi: 10.1186/1476-4598-11-14

Figure Lengend Snippet: CD133 and CD44 expression are upregulated in PD173074-resistant cells . Resistant Huh7 cells were generated by culturing in sub-lethal concentrations of PD173074 (0.1 μM - 1.0 μM). After eight weeks, (A) CD133 and (B) CD44 mRNA expression were analyzed by qRT-PCR. Results are indicated with SD converted to fold changes as error bars. The differences were statistically significant ( P < 0.001 by one-way ANOVA, P < 0.05 by Tukey's multiple comparison test). (C) CD133 protein expression was determined by immunoblotting and normalized to β-actin. (D) Long term effect of PD173074 treatment on FGFR4 and KLB protein expression were determined by immunoblot assays. For (C) and (D), the respective relative protein levels were calculated relative to DMSO control after normalizing the protein band density to that of the loading control.

Article Snippet: To establish stable FGFR4 knockdown clones, Huh7 cells were transfected with pRS vector control (TR20003, Origene Technologies, Rockville, MD) and FGFR4-specific HuSH 29mer shRNA constructs (TR320356, Origene) and selected with 2 μg/mL puromycin (Sigma) for at least 14 days as previously described [ ].

Techniques: Expressing, Generated, Quantitative RT-PCR, Western Blot

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 suppresses MST1/2 activation and nuclear localization in cancer cell spheres. a shScr and shFGFR4 MDA-MB-453 cell spheres were cultured under non-adherent conditions (10% or 2% FBS), and subjected to immunoblotting. Arrowhead; cleaved N-terminal MST1/2 (in 2% FBS), brackets highlight the fragments of autoactivated MST1/2. b MDA-MB-453 cell spheres were treated with 100 n m BLU9931 for 15 min, and subjected to immunoblotting. c , d shScr and shFGFR4 MDA-MB-453 and ZR-75.1 spheres were analyzed for MST1 expression by c immunofluorescence, and d MST1 nuclear/cytoplasmic ratio was quantified ( n = 4–6 MDA-MB-453 spheres, ≥ 6 microscopic fields/sphere; n = 2–3 ZR-75.1 spheres, ≥ 8 microscopic fields/ sphere; mean ± SEM of two independent experiments. Scale bar 10 µm. e shScr and shFGFR4 MDA-MB-453 cells were transfected with indicated siRNAs before sphere formation, cultured under non-adherent conditions (1% FBS) for 48 h, and subjected to immunoblotting

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Activation Assay, Cell Culture, Western Blot, Expressing, Immunofluorescence, Transfection

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: MST1-Y433F phosphosite mutant restores MST1/2 activation in FGFR4 expressing cancer cells. a MDA-MB-231 cells co-transfected with FGFR4 (R) and wild-type or phosphosite mutant MST1-Y433F were subjected to immunoblotting as indicated. Ratio of pMOB1/MOB1 is indicated below the immunoblot panel. b T47D cells (co-)transfected with wild-type or MST1-Y433F alone or with FGFR4 (R) were treated with 1 µ m okadaic acid for 1 h before cell lysis, and subjected to immunoblotting. See corresponding T47D immunoblots without okadaic acid in Fig. S4C. c T47D cells with indicated siRNAs, and (co-)transfected with wild-type or MST1-Y433F alone or with FGFR4 (R) were treated with 1 µ m okadaic acid as above, and subjected to immunoblotting. a–c Brackets and arrowhead indicate the activated pMST1/2 fragments. N = 2 independent repeats

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Phospho-proteomics, Mutagenesis, Activation Assay, Expressing, Transfection, Western Blot, Lysis

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 substrate screen identifies tyrosine-phosphorylated Hippo pathway proteins including MST1/2. a Scheme of the substrate screen with recombinant FGFR4 kinase domain. b Top 10 FGFR4 substrates ranked by the Z-score include Hippo pathway -associated proteins (yellow). See Table S1 for the full substrate list. c , d MST1/2 are tyrosine phosphorylated by FGFR4 in COS-1 cells. Flag-tagged MST1/2 were immunoprecipitated after transfection of MST1 and MST2 alone or in combination with FGFR4 G388 (G), or R388 (R) kinase (wt), or kinase-dead (KD) variants, and detected by immunoblotting. e MST1 immunoprecipitates from COS-1 cells co-transfected with FGFR4 (R)-wt or FGFR4 (R)-KD (See Fig. S1A) were trypsin digested and subjected to phoshopeptide enrichment prior to LC-MS/MS analysis ( N = 3) that identified phosphorylated Y433 (red) on MST1 only with FGFR4 (R)-wt, and phosphorylated S410 (green) only with FGFR4 (R)-KD

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Recombinant, Immunoprecipitation, Transfection, Western Blot, Liquid Chromatography with Mass Spectroscopy

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: List of MST1 phoshopeptides identified by mass spectrometry

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Sequencing

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 is overexpressed in HER2 + , MST1/2 low breast cancer cells. a , b FGFR4 and HER2 expression in luminal MDA-MB-453, ZR-75.1, and BT474, MCF7, and T47D, and five triple-negative breast cancer cell lines by a immunoblotting and b immunofluorescence. Scale bar 20 μm. c MST1, MST2, and YAP/TAZ expression in these cell lines, detected by immunoblotting ( N = 3)

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Expressing, Western Blot, Immunofluorescence

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 suppresses MST1/2 activation and cleavage in HER2 + breast cancer cells. a , b MDA-MB-453 cells transfected with indicated siRNAs were subjected to immunoblotting for a T183/180 phosphorylated MST1/2, and b MST1 and MST2. Note cleaved ~ 37 kDa MST1/N in FGFR4 knockdown cells (arrowhead). Thin gray line indicates cropping to leave out irrelevant sample lane; see uncropped immunoblots in Fig. S8. c MDA-MB-453 cells transduced with indicated shRNAs were transfected with siScr or siFGFR4 siRNA to 3’UTR before transfection of mock or FGFR4 (R) or (G) overexpression plasmid for a rescue experiment. Lysates were subjected to immunoblotting as indicated. Brackets indicate the cleaved MST1 and MST2 fragments. See Fig. S2A for phopsho-FRS2α and short exposure of MST1. d MDA-MB-453 and ZR-75.1 cells were transduced with indicated si/shRNAs; upper, indicated immunoblots of lysates; lower, quantification of pMOB1/MOB1 ratio, N = 3, mean ± SEM; * P < 0.05. For MST1/2 knockdown e ZR-75.1 and f MDA-MB-453 were transduced with shRNAs followed by transfection with siRNAs as indicated, and g BT474 cells were transfected with indicated siRNAs, and subjected to immunoblotting for pT183/180 MST1/2, MST1, MST2, and pMOB1 as indicated (in e arrowhead points to a full-length, bracket to the cleaved MST2) a–g . N = 3 independent repeats for all; except N = 2 in f and g

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Activation Assay, Transfection, Western Blot, Knockdown, Transduction, Over Expression, Plasmid Preparation

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 counteracts MST1/2-mediated apoptosis. MDA-MB-453 cells transduced with shScr or shFGFR4 shRNAs were transfected with siRNA pools specific for FGFR4, MST1 or MST2, and analyzed for annexin V and propidium iodide (PI) binding by flow cytometry using two different gating strategies for data visualization. a Gating to populations P1 (smaller) and P2 (larger), and annexin V binding (FL1-A) histograms as a marker for early apoptotic cells. b Quantification (% of total, 100,000 events) of apoptosis based on double-positive (annexin V + PI) cells, including both early and late apoptotic stages. See Fig. S3B for representative contour plots and quadrant gating. Mean ± SD of triplicates shown, ** P < 0.01; (repeated three times; N = 3). FSC-A; forward scatter, and SSC-A; side scatter

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Transduction, Transfection, Binding Assay, Flow Cytometry, Marker

Journal: Cell Death and Differentiation

Article Title: FGFR4 phosphorylates MST1 to confer breast cancer cells resistance to MST1/2-dependent apoptosis

doi: 10.1038/s41418-019-0321-x

Figure Lengend Snippet: FGFR4 confers resistance to apoptotic modulators in comprehensive drug screen. a (Phospho)protein changes in TCGA RPPA data associated with FGFR4 upregulation in breast cancer, visualized using cBioPortal (RPPA score change in breast cancer tumors with and without alterations in FGFR4; (mean FGFR4 altered – mean FGFR4 unaltered) [ , ]. The most significantly up- and downregulated proteins are highlighted (pink dots); ERBB2, alternative name of HER2; PR, progesterone receptor. b–g Fibrin embedded single-cell suspensions of b–d MDA-MB-453 and e–g ZR-75.1 cells were treated with 100 n m BLU9931 and/or 30 ng/ml FGF1 over a 13–14-day culture, fixed, embedded into paraffin for sectioning, and subjected to immunohistochemistry for Ki67 and BAX expression. Positively stained vs. total number of cells per colony were counted ( N = 30, mean ± SD, ** P < 0.01). Scale bar 50 µm in b and e . b For comprehensive drug sensitivity testing ( N = 1), MDA-MB-453 cells were treated with 527 compounds in five-point dose either alone or in combination with specific FGFR4 inhibitor BLU9931. Dotplot showing the difference in DSS (drug sensitivity score) for cells in treatment combination with BLU9931 (100 n m ) versus single agent treatments. Negative values are compounds inducing larger decreases in viability as single agents; positive scores indicate compounds yielding larger decreases in viability in the presence of BLU9931. Colors demarcate compounds with similar class

Article Snippet: Rabbit polyclonal antibodies against FGFR4 (sc-124; Santa Cruz), phospho-FGFR4 (pY642; CSB-PA008250, Cusabio Technology, Houston, TX, USA) and phospho-FRS2-α (pY196; 3864), MST1 (3682), MST2 (3952), phospho-p44/42 MAPK (phospho-Erk1/2) (pT202/pY204; 9101), phospho-AKT (pS473; 9271), phospho-MST1/2 (pT183/pT180; 3681), phospho-YAP (pS127; 4911) all from Cell Signaling Technology, V5-tag (ab9116; Abcam), and horseradish peroxidase–conjugated secondary antibodies (P044701 and P044801, Dako, Santa Clara, CA, USA) for enhanced chemiluminescence detection of immunoblots.

Techniques: Immunohistochemistry, Expressing, Staining

Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Serum FGFR4 levels in patients with PA and the reference group.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Association of FGFR4 rs351855 genotype with the p53 H-score in PA patients. Boxplots illustrate the distribution of p53 H-scores across GG, GA, and AA genotypes. The median, interquartile range (IQR), and whiskers representing minimum and maximum values are shown.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: International Journal of Molecular Sciences

Article Title: Insights into FGFR4 (rs351855 and rs7708357) Gene Variants, Ki-67 and p53 in Pituitary Adenoma Pathophysiology

doi: 10.3390/ijms26157565

Figure Lengend Snippet: Associations of FGFR4 rs7708357 genotype with the p53 H-score in PA patients. Boxplots illustrate the distribution of p53 H-scores across GG, GA, and AA genotypes. The median, interquartile range (IQR), and whiskers representing minimum and maximum values are shown.

Article Snippet: The specific TaqMan ® SNV Genotyping Assays used for each SNV are detailed below: rs351855 C___3166614_10; Sequence [VIC/FAM]: CTTGGCTGTGCTCCTGCTGCTGGCC[A/G]GGCTGTATCGAGGGCAGGCGCTCCA rs7708357 C__11270571_20; Sequence [VIC/FAM]: TTGCATTGCTACCCAGATGCTGCTG[A/G]TCTGGGGAAGGAGTGGGGGTCACAC.

Techniques:

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: Impact of FGFR4 overexpression on tumor cell growth and migration in vitro. Stable transfectants overexpressing FGFR4arg or FGFR4gly in SW480, HCT116, or HT29 cells were used to assess growth and malignant characteristics in vitro. Stable transfectants with the pcDNA3 vector were used as controls. A, 100 and 200 cells were seeded/6-well, medium was changed after 24 hours, and the number of colonies counted after 10 days of growth. B, five thousand cells each were suspended in soft agar medium and plated in 6-well plates. The number of colonies was counted at a magnification of 10-fold after 3 weeks of growth. C, cell migration was determined by filter migration assay from 2 × 104 cells/24-well. Photographs of cultures show representative results from SW480 transfectants. Quantitative results from all cell lines were calculated as % of control, pooled from at least 3 independent experiments, and presented as mean ± SD. *, **, *** indicate an increase as compared with the control at P < 0.05, 0.01, and 0.001, respectively. ## indicates a decrease as compared with control at P < 0.01. &, &&, and &&& indicate a difference between the FGFR4gly and FGFR4arg groups at P < 0.05, 0.01, and 0.001, respectively.

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: Over Expression, Migration, In Vitro, Plasmid Preparation, Control

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: Impact of FGFR4 knockdown on clonogenicity and migration in vitro. siRNA oligonucleotides were introduced by lipofection into HCT116 and HT29 cells. Controls were transfected with scrambled control siRNA. A, five days after knockdown, cell viability was measured by MTT assay. B, 24 hours after knockdown, proliferation was determined by 3H-thymidine uptake. From parallel cultures, cells were harvested 24 hours after transfection and plated at 100 and 200 cells/6-well for colony formation assays (C) and 2 × 104 cells/filter for migration assays (D). Results were pooled from at least 3 independent experiments and presented as mean ± SD. # and ## indicate a decrease as compared with control at P < 0.05 and 0.01, respectively.

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: Knockdown, Migration, In Vitro, Transfection, Control, MTT Assay

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: FGFR4-dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: Phospho-proteomics, Western Blot

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: Impact of FGFR4 overexpression on tumor growth and metastasis in vivo. 106 cells each of SW480gly, SW480arg, and SW480co cells were injected s.c. into SCID mice. A and B, tumor growth was monitored and the mice sacrificed when tumor size reached 5 cm3 or after 9 weeks, whichever came first. The tumors were analyzed by immunohistochemistry using antibodies recognizing cytokeratin 20 and Ki67. C and D, lungs were isolated from tumor-bearing mice and fixed with formalin. Serial sections were stained using antibodies recognizing Ki67 to detect tumor cells that were scored according to the criteria given in Supplementary Materials.

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: Over Expression, In Vivo, Injection, Immunohistochemistry, Isolation, Staining

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: FGFR4 (rs351855) genotype distribution and CRC risk

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: Control

Journal: Cancer research

Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

doi: 10.1158/0008-5472.CAN-11-3654

Figure Lengend Snippet: FGFR4 (rs351855) genotype distribution and CRC tumor stage

Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

Techniques: